PCR beads, Ready-To-Go™ You-Prime First-Strand Beads

Toimittaja: Cytiva
27-9264-01EA 494 EUR
PCR beads, Ready-To-Go™ You-Prime First-Strand Beads
Nukleiinihapporeagenssit RT-PCR and cDNA Reagents
  • Pre-dispensed, single-dose reaction beads minimise pipetting errors, avoid cross-contamination, and ensure optimal performance
  • First-strand reaction beads contain no primer, thus allowing users to select a first-strand primer of choice
  • Highly suitable for research applications that use PCR to detect and quantify eukaryotic RNA from a variety of samples
  • Reaction beads are function tested for first-strand synthesis of cDNA up to 7,5 kb and in RT-PCR from blood samples

Completed reactions (33µL final volume) can be used in PCR after adding water, Taq DNA polymerase, and primers; first-strand cDNA can also be used as a template for traditional Gubler-Hoffman second-strand cDNA synthesis.

Tilaustiedot: First-strand reaction mix (50 white tubes): Two beads containing reaction buffer, dATP, dCTP, dGTP,dTTP, Murine reverse transcriptase (FPLCpure), RNAguard™ (porcine), RNase/DNase-free BSA.
Control mix bead (5 red tubes): One ambient-temperature-stable bead containing rabbit globin mRNA (1 ng), buffer and 8 pmol each of 5’-specific globin primer (5’d[ACACTTCTGGTCCAGTCCGACTGAG]-3’) and 3’-specific globin primer (5’-d[GCCACTCACTCAGACTTTATTCAAA]-3’).
Order Now

Learn more

About VWR

Avantor is a vertically integrated, global supplier of discovery-to-delivery solutions for...

Lue lisää About VWR